Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU042191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wee1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAAGACATGGAAGCCAGTGATTATGAGTTTGAAGATGAAACAAGACCTGCCAAAAGAATTACAATTACTGAAAGCAACATGAAGTCACGGTATACAACTGAATTTCATGAGCTGGAGAAAATTGGTTCTGGAGAATTTGGTTCTGTGTTTAAATGTGTGAAGAGGTTAGATGGATGCATTTATGCCATTAAACGATCAAAAAAACCATTGGCTGGCTCTGTTGATGAGCAGAATGCTTTGAGAGAAGTGTATGCTCACGCTGTGCTTGGACAGCACCCCCACGTCGTTCGCTATTTCTCTGCCTGGGCAGAGGATGACCACATGCTTATACAGAACGAATACTGTAATGGTGGGAGTTTAGCTGATGCTATAAGTGAGAACTACAGAGTCATGAGCTACTTGACTGAAGTAGAGCTGAAGGATCTCCTTTTGCAAGTTGGCCGGGGCTTGAGATACATACATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTAATATTTTTATATCTCGAACCTCAATCCCAAATGCTG

Ensembl | nº de acceso | ratón

ENSMUSG00000031016

Nº de acceso NCBI

NM_009516

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... WEE1(22390) , Wee1(22390)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ana Slipicevic et al.
Gynecologic oncology, 135(1), 118-124 (2014-08-06)
Wee1-like kinase (Wee1) is a tyrosine kinase which negatively regulates entry into mitosis at the G2 to M-phase transition and has a role in inhibition of unscheduled DNA replication in S-phase. The present study investigated the clinical role of Wee1
Koji Hatano et al.
Nucleic acids research, 43(8), 4075-4086 (2015-04-08)
MicroRNAs (miRNAs) have been implicated in DNA repair pathways through transcriptional responses to DNA damaging agents or through predicted miRNA regulation of DNA repair genes. We hypothesized that additional DNA damage regulating miRNAs could be identified by screening a library
Gry Irene Magnussen et al.
BMC cancer, 15, 462-462 (2015-06-10)
Malignant melanoma has an increasing incidence rate and the metastatic disease is notoriously resistant to standard chemotherapy. Loss of cell cycle checkpoints is frequently found in many cancer types and makes the cells reliant on compensatory mechanisms to control progression.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico