Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU041951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pdcd4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTGGGCCAGTTTATTGCTAGAGCTGTTGGAGATGGAATCTTATGTAATACCTATATCGATAGTTACAAAGGAACTGTAGATTGTGTACAGGCTCGAGCTGCTCTGGATAAGGCTACTGTGCTCCTGAGTATGTCCAAAGGCGGGAAGCGGAAAGACAGTGTGTGGGGATCTGGAGGCGGGCAACAGCCTGTCAATCACCTTGTTAAAGAGATTGATATGCTGCTTAAAGAGTATTTACTCTCTGGAGATATATCTGAAGCTGAACACTGCCTTAAGGAACTGGAAGTACCTCATTTTCACCACGAGCTTGTATATGAAGCCATTATAATGGTTTTAGAGTCAACTGGAGAAAGTGCATTCAAGATGATCTTAGATTTATTAAAATCCTTGTGGAAGTCTTCTACTATTACCATAGACCAAATGAAAAGGGGCTATGAGAGAATTTACAATGAAATCCCAGACATTAATCTGGATGTCCCGCACTCATACTCTGTTCTTGAGAGATTTGTGGAGGAATGTTTTCAGGCTGGAA

Ensembl | nº de acceso | ratón

ENSMUSG00000024975

Nº de acceso NCBI

NP_035180

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... PDCD4(18569) , Pdcd4(18569)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JRS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qiang Su et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1426-1433 (2015-03-15)
The aim of this study was to investigate the role of the programmed cell death factor 4 (PDCD4)/nuclear factor-κB (NF-κB) signaling pathway in coronary micro-embolism (CME)-induced inflammatory responses and cardiac dysfunction in a porcine model. Bama miniature pigs were randomly
Chuankui Wei et al.
Oncology reports, 34(1), 211-220 (2015-06-13)
Numerous studies have demonstrated that microRNAs (miRNAs) play vital roles in papillary thyroid carcinoma (PTC). The aim of the present study was to examine the expression levels of miR-183 in PTC and investigate whether its potential roles involved targeting the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico