Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU039811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Irak1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGATTGGAGAGGGTGGTTTTGGATGTGTGTACCGAGCAGTCATGAGAAATACTACATATGCTGTGAAGAGACTGAAGGAGGAAGCTGACCTAGAGTGGACTATGGTGAAACAGAGCTTCTTAACAGAGGTGGAACAGCTATCAAGGTTTCGTCACCCAAATATCGTAGACTTTGCTGGCTACTGTGCAGAGAGTGGCTTATACTGCCTTGTTTATGGCTTCTTGCCCAATGGCTCCTTGGAGGATCAGCTCCACCTTCAGACCCAGGCCTGCTCCCCACTTTCCTGGCCTCAACGACTGGACATTCTTCTGGGCACAGCCCGGGCTATTCAGTTTTTACATCAGGATAGCCCCAGCCTTATCCATGGAGACATCAAGAGTTCTAACGTGCTTCTGGATGAGAGACTGATGCCCAAGCTGGGAGACTTTGGCCTGGCTCGTTTCAGCCGCTTTGCGGGGGCCAAAGCAAGCCAGAGCAGTACTGTGGCCCGGACTTCCACAGTTCGAGGTACCC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Florian Meisgen et al.
The Journal of investigative dermatology, 134(7), 1931-1940 (2014-03-29)
Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response
Zhen Ning Wee et al.
Nature communications, 6, 8746-8746 (2015-10-28)
Metastatic tumour recurrence due to failed treatments remains a major challenge of breast cancer clinical management. Here we report that interleukin-1 receptor-associated kinase 1 (IRAK1) is overexpressed in a subset of breast cancers, in particular triple-negative breast cancer (TNBC), where

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico