Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU037541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Marcks

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACCCCGCATCTTATTAGCAACCAGGGAGATTTCTCCATTTTCCTCTTGTCTACAGTGCGGCTACAAATCTGGGATTTTTTTTTATTACTTCTTTTTTTAAAAAAACTACACTTGGGCTCCTTTTTTGTGCTCGACTTTTCCACCTTTTTCCCTCCTTCCTGCGCTGCTGCTTTTTTGATCTCTTCGACTAAAAATTTTTTATCCGGAGTATTTAATCGGGTCTCTTCTGTCCTCCTCGCCACCCCCACCCCCTCCCTCCGGTGTGTGTGCCGCCGCCGCTGTTGCTGCTGCTGCTGCTCGCCCCGTCGTTACACCAACCGAAGGCTCTTTGTTTCCTCTCTTGGATCTGTTGAGTTTCTTTGTTGAAGAAGCCAGCATGGGTGCCCAGTTCTCCAAGACCGCAGCGAAGGGAGAAGCCACCGCCGAGAGGCCCGGGGAGGCGGCTGTGGCCTCGTCGCCTTCCAAAGCAAATGGGCAGGAGAATGGCCACGTAAAA

Ensembl | nº de acceso | ratón

ENSMUSG00000069662

Nº de acceso NCBI

NM_008538

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MARCKS(17118) , Marcks(17118)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ching-Hsien Chen et al.
Oncotarget, 6(17), 15194-15208 (2015-05-28)
Accumulating evidence has suggested that myristoylated alanine-rich C-kinase substrate (MARCKS) is critical for regulating multiple pathophysiological processes. However, the molecular mechanism underlying increased phosphorylation of MARCKS at Ser159/163 (phospho-MARCKS) and its functional consequence in neoplastic disease remain to be established.
C-H Chen et al.
Oncogene, 33(28), 3696-3706 (2013-08-21)
Myristoylated Alanine-Rich C Kinase Substrate (MARCKS), a substrate of protein kinase C, is a key regulatory molecule controlling mucus granule secretion by airway epithelial cells as well as directed migration of leukocytes, stem cells and fibroblasts. Phosphorylation of MARKCS may
Dan Yu et al.
Journal of the American Heart Association, 4(10), e002255-e002255 (2015-10-10)
Transcription of the myristoylated alanine-rich C kinase substrate (MARCKS) is upregulated in animal models of intimal hyperplasia. MARCKS knockdown inhibits vascular smooth muscle cell (VSMC) migration in vitro; however, the mechanism is as yet unknown. We sought to elucidate the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico