Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU033881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xrcc2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGAGCAGCCGGTTCTCATTAGTTTCACGTCATTTAAAAAGTAACAGTTTAAAAAAACACAGTTTTATGGTCAGAGAAAGTGGGGTGGAGTTTTGTTGATCTCTATCATCAAAAAGGCTTTTAGGTGCACTAAGGCAAGTCTTTAAAAGTCCTTTATAGGCTAAAGTGGTTTGATTCTAAAGTTTGTAATTCTGGGGAAATTAAATAGTACAGAAAAACTCGAAGCTGTTCTGTCCCCTTCAAGGTGTGGAAGGTCAGTCAGAACATGCTAAACTCCACCGAGCTTGTCTTGAAGCTCAAACCATGATACACATTTCAGACTAGGTCACTTTCTGCATACTTTAGGAAGGGTTCACCGCTGGTCCCTTGGCTCCTAGAGGCTGTGGCTGGAGAGAGTGCACAGAGCTGTTACTCTAATCAAAGGAAGACACACAGGGCCACCAGCTCATCTGCCTCCCTCAGGAAACTGGAATGAGCTGGGTG

Ensembl | nº de acceso | ratón

ENSMUSG00000028933

Nº de acceso NCBI

NM_020570

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... XRCC2(57434) , Xrcc2(57434)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jennifer M Mason et al.
Cancer research, 74(13), 3546-3555 (2014-04-23)
RAD51 is the central protein that catalyzes DNA repair via homologous recombination, a process that ensures genomic stability. RAD51 protein is commonly expressed at high levels in cancer cells relative to their noncancerous precursors. High levels of RAD51 expression can
Xinzhu Deng et al.
PloS one, 10(6), e0127862-e0127862 (2015-06-30)
Mammalian NOTCH1-4 receptors are all associated with human malignancy, although exact roles remain enigmatic. Here we employ glp-1(ar202), a temperature-sensitive gain-of-function C. elegans NOTCH mutant, to delineate NOTCH-driven tumor responses to radiotherapy. At ≤20°C, glp-1(ar202) is wild-type, whereas at 25°C

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico