Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU030691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Uhrf1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAAGCGGATGACAAGACTGTGTGGGAGGACACGGACCTGGGGCTGTACAAGGTCAATGAGTATGTGGACGTGCGTGACAATATCTTCGGTGCATGGTTTGAGGCCCAGGTGGTCCAGGTACAGAAGAGAGCCCTATCTGAGGACGAGCCCTGTAGCTCCAGTGCCGTTAAGACCTCGGAGGATGACATCATGTACCATGTCAAGTATGATGACTATCCAGAGCATGGAGTGGACATTGTCAAAGCCAAGAATGTCCGTGCTCGTGCTCGCACTGTGATACCATGGGAGAACCTGGAGGTGGGTCAGGTGGTCATGGCCAACTATAACGTGGACTACCCCAGGAAACGCGGCTTCTGGTATGATGTTGAGATCTGTAGGAAGCGCCAAACCAGGACGGCACGTGAGCTATACGGCAACATCAGGCTCTTGAATGACTCTCAGCTCAACAACTGTCGGATCATGTTTGTGG

Ensembl | nº de acceso | ratón

ENSMUSG00000001228

Nº de acceso NCBI

NM_001111080

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... UHRF1(18140) , Uhrf1(18140)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Feng Yan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 8887-8893 (2015-06-14)
Ubiquitin-like with PHD and ring finger domains 1 (UHRF1), known as ICB90 or Np95, has been found to be overexpressed in numerous cancers. In this study, we evaluated the expression level of UHRF1 in ovarian cancer. UHRF1 levels in paired
Yiyu Qin et al.
Oncology reports, 31(6), 2635-2643 (2014-04-24)
Ubiquitin-like containing PHD and RING finger domains 1 (UHRF1), overexpressed in various human malignancies, functions as an important regulator in cell proliferation and epigenetic regulation. Depletion of UHRF1 has shown potential antitumor activities in several types of cancer. However, the role

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico