Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU030541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usf1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTGATCCAGGGAGCTTTCACCAGTGACGATGCCGTTGACACGGAGGGAGCAGCTGCTGAGACACATTATACATATTTCCCCAGCACCGCAGTGGGAGATGGGTCAGGGGGCACCACATCTGGGAGTACAACAGCTGTTGTTACCACCCAGGGCTCAGAGGCACTACTGGGGCAGGCAACCCCGCCCAGCACAGGTCAATTCTTTGTGATGATGTCACCACAAGAAGTATTGCAGGGAGGGAGCCAGCGATCGATTGCCCCCAGGACCCACCCTTATTCCCCGAAGTCAGAGGCTCCCAGGACAACACGAGATGAGAAACGGAGGGCTCAACATAACGAAGTGGAGCGCCGCCGCCGGGACAAGATCAACAACTGGATTGTACAGCTGTCCAAAATCATCCCAGACTGCTCTATGGAGAGCACCAAGTCTGGCCAGAGTAAAGGTGGAATCCTGTCCAAAGCCTGTGATT

Ensembl | nº de acceso | ratón

ENSMUSG00000026641

Nº de acceso NCBI

NM_009480

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... USF1(22278) , Usf1(22278)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Chen-Chia Hung et al.
The Journal of general virology, 96(9), 2855-2866 (2015-08-25)
During its lytic cycle, Epstein-Barr virus (EBV) expresses Rta, a factor encoded by BRLF1 that activates the transcription of viral lytic genes. We found that upstream stimulating factor (USF) binds to E1, one of the five E boxes located at

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico