Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU030461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gtf2h1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAGAAGCAGGATGGAGCACTGTACCTCATGGCAGAGAGAATTGCTTGGGCACCTGAAGGCAAAGACAGATTTACAATCAGCCATATGTATGCAGATATTAAATGCCAGAAAATCAGTCCAGAGGGAAAAGCTAAAATACAACTTCAGCTGGTCCTGCATGCAGGGGACACAACAAACTTCCATTTTTCCAACGAAAGCACGGCAGTGAAAGAACGGGATGCAGTGAAGGACCTCCTTCAGCAGCTGCTGCCCAAGTTCAAGCGGAAAGCTAATAAAGAGCTGGAGGAGAAGAACAGAATGCTCCAAGAAGATCCTGTTTTATTCCAACTCTATAAAGACCTTGTTGTGAGCCAAGTGTTCAGTGCTGAGGAATTCTGGGCCAATCGTTTAAATGTGAATGCAACAGATAGTTCTACATCCAGTCACAAGCAGGATGTTGGTATTTCTGCAGCATTTCTGGCTGATGTCC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Leticia M Ignacio-Souza et al.
Endocrinology, 155(8), 2831-2844 (2014-06-04)
In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
Kaori Kojima et al.
Neuroscience letters, 581, 37-41 (2014-08-26)
p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
Young-Ok Son et al.
The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions
Young-Ok Son et al.
The Journal of biological chemistry, 290(45), 27090-27100 (2015-09-20)
Arsenic (As(3+)) is a carcinogen with considerable environmental and occupational relevancy. The present study shows that As(3+)-transformed human lung bronchial epithelial BEAS-2B cells (AsT cells) exhibit the property of apoptosis resistance. The level of basal reactive oxygen species (ROS) is
Ashwani Khurana et al.
Oncotarget, 6(34), 36354-36369 (2015-10-27)
A promising new strategy for cancer therapy is to target the autophagic pathway. In the current study, we demonstrate that the antimalarial drug Quinacrine (QC) reduces cell viability and promotes chemotherapy-induced cell death in an autophagy-dependent manner more extensively in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico