Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU029651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt10a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTCTGGGTCTCAAGAATGGTTGTCCTCTTGGTGCCTGGCTTCTGCCGCTAGCGGATCTGAGCCAGGCAGCAAGCAGCAGCCTTGGCTCCTGAGAGAGGTGGTTGGCTCTTACAGCCCCGAGGGTCTACAATCACCAGACAGTCCAGATCTGATTGACATTCCTCCGCTCACCTCTGTAGGTTCCCCTCTTTCTGTTCCTAGCTCAGACAGCTGGGGGTGATAGTGGAGACTGTTCCACACCCTAGGACAGGTCACCAAAGCAGCCCAGCCTGGCATGCCTACCTCCTGTCATCTCTTCTTCCCTTCCCCAGGAGTGATAGGCAATGCACTGAAGCTGATGGGCACCGGGGAAGAAAACTAAAAGGCAGAAATGGCCGTCATCGGGCTGAAGTGACTCTAAGGGCTCCAGACCTCTGCTCCTGTCTTTCACTTAACAGATATTTATTTTTGCGCTCTCTTTGAGACA

Ensembl | nº de acceso | ratón

ENSMUSG00000026167

Nº de acceso NCBI

NM_009518

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... WNT10A(22409) , Wnt10a(22409)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fujun Yu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2409-2420 (2016-11-11)
Wnt/β-catenin pathway is involved in liver fibrosis and microRNAs (miRNAs) are considered as key regulators of the activation of hepatic stellate cells (HSCs). A recent study showed the protective role of miR-378a-3p against cardiac fibrosis. However, whether miR-378a-3p suppresses Wnt/β-catenin
Jia Jing et al.
Adipocyte, 9(1), 401-414 (2020-07-24)
We discovered a unique expression pattern of two histone methyltransferases Suv39h1 and Suv39h2 during 3T3-L1 adipogenesis, both of which preferentially catalyse the formation of H3K9 dimethylation (H3K9me2) and further H3K9 trimethylation (H3K9me3), a transcriptional repressive mark. The expression of Suv39h1
Ren-Jun Hsu et al.
PloS one, 7(10), e47649-e47649 (2012-10-25)
Renal cell carcinoma (RCC) is a malignancy with poor prognosis. WNT/β-catenin signaling dysregulation, especially β-catenin overactivation and WNT antagonist silencing, is associated with RCC carcinogenesis and progression. However, the role of WNT ligands in RCC has not yet been determined.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico