Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU028811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dym

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTTCAATCGGTCCATTCATGAAGTGATATTAAGAAACATTACTTGGTATTCAGAAAGAGTCTTAACTGAGATTTCCCTGGGGAGCCTCCTAATTCTGGTGGTAATAAGAACCATCCAGTACAATATGACCAGGACTCGAGACAAGTACCTGCACACAAACTGCCTGGCGGCTTTAGCAAACATGTCAGCGCAGTTCCGCTCCCTCCACCAGTACGCTGCCCAGAGGATCATCAGTTTGTTTTCTTTGCTGTCTAAAAAACACAACAAGGTCCTGGAGCAAGCCACGCAGTCCTTGAGAGGTCCCCTGAGCTCCAGCGATGTCCCTCTCCCAGATTATGCACAGGACCTCAGTGTCATTGAAGAAGTGATTCGGATGATGCTGGAGATCATCAACTCCTGCCTGACAAATTCTCTTCACCACAACCCAAACTTGGTGTACGCCTTGCTTTACAAACGGGACCTC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Huijun Ying et al.
PloS one, 7(3), e32892-e32892 (2012-04-06)
Chronic rejection is the major cause of long-term heart allograft failure, characterized by tissue infiltration by recipient T cells with indirect allospecificity. Phosphoinositol-3-kinase p110δ is a key mediator of T cell receptor signaling, regulating both T cell activation and migration
Rosalind V Silverman-Gavrila et al.
Cytoskeleton (Hoboken, N.J.), 72(4), 157-170 (2015-04-24)
Directed migration of smooth muscle cells (SMCs) from the media to the intima and their subsequent proliferation are key events in atherosclerosis as these cells contribute to the bulk and stability of atheromatous plaques. We showed previously that two cytoskeleton-associated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico