Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU028161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc2a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGAATCTCTGGCAAAATGGCCCTGAAGCACCCGTACTTTGATGACTTGGACAATCAGATTAAGAAGATGTAGCCCTCTGGATGGATGTCCCTGTCTGCTGGTCGTAGGGGAAGATCGTGTTGTTTACCGTTGGCTCTCTTCCTGTCTTGTATAGTTTTCTTTGTTTGTAAACTGTCATCTGGACTTTTCTTAATTTCCTACGTATAACTTAATTAACATGTAAATATTATTCCATATGAATTTAAATATAATTCTGTATATGTGCAGATGTCACTGTGGTGGCTGTTAATTACTATAACACAAGTGTTAATTACTACAACATAAGACTTGAGTCTCCCTAGACTTCCCAGCAGCCATTCCTGCAGCTCGGAGCACAGTTGAAGGAGCTGAGCTCAGGCCTCGTGATGCTTTCAAGTGCCTCCGTGTTCTGGATATATATGATTCCTGGTCAGTTTCTTGCC

Ensembl | nº de acceso | ratón

ENSMUSG00000019942

Nº de acceso NCBI

NP_031685

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CDC2A(12534) , Cdc2a(12534)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Gunjan Guha et al.
PloS one, 10(5), e0125322-e0125322 (2015-05-06)
Pactamycin, although putatively touted as a potent antitumor agent, has never been used as an anticancer drug due to its high cytotoxicity. In this study, we characterized the effects of two novel biosynthetically engineered analogs of pactamycin, de-6MSA-7-demethyl-7-deoxypactamycin (TM-025) and
Qinghua Xi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 4939-4948 (2015-04-26)
Overexpression of cyclin-dependent kinase 1 (CDK1) has been noted to correlation with several human cancers. However, the effects of CDK1 on ovarian cancer development remain unclear. The aim of this study was to examine the effect of CDK1 and related
Qing Xia et al.
International journal of oncology, 44(3), 735-744 (2014-01-01)
Breast cancer is one of the most common malignancies in women. Approximately 15% of the patients belong to the triple-negative breast cancer (TNBC) group, and have the disadvantage of not benefiting from currently available receptor-targeted systemic therapies. Some cancers in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico