Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU025471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sirt6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGTCAGAGACACGGTTGTGGGCACCATGGGCCTCAAGGCCACAGGCCGGCTCTGCACCGTGGCCAAGACCAGGGGACTTCGGGCCTGTAGAGGGGAGCTGAGAGACACCATTCTGGACTGGGAGGACTCGTTGCCTGACCGGGACCTGATGCTCGCTGATGAGGCCAGCAGGACCGCAGACCTGTCTGTCACCCTGGGTACCTCGCTGCAGATCCGCCCCAGTGGGAACCTGCCCCTTGCCACTAAGCGCCGAGGAGGCCGTCTGGTCATTGTCAACCTGCAACCCACAAAACATGACCGCCAGGCTGACCTGCGCATCCACGGCTACGTGGATGAGGTGATGTGCAGACTCATGAAGCATCTGGGGCTGGAGATTCCAGCCTGGGATGGACCCTGCGTGCTAGACAAAGCCCTGCCACCTCTGCCTCGCCCAGTAGCACTCAAGGCTGAGCC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mei Ming et al.
Cancer research, 74(20), 5925-5933 (2014-10-17)
SIRT6 is a SIR2 family member that regulates multiple molecular pathways involved in metabolism, genomic stability, and aging. It has been proposed previously that SIRT6 is a tumor suppressor in cancer. Here, we challenge this concept by presenting evidence that
Tomohiko Fukuda et al.
FEBS letters, 589(17), 2274-2281 (2015-07-18)
SIRT6, a member of the sirtuin family, has been identified as a candidate tumor suppressor. To pursue the role of SIRT6 in endometrial cancer, we investigated the anti-tumorigenic function of SIRT6. The expression of SIRT6 negatively affected the proliferation of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico