Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU024521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ucp2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTGAGCTGGTGACCTATGACCTCATCAAAGATACTCTCCTGAAAGCCAACCTCATGACAGATGACCTCCCTTGCCACTTCACTTCTGCCTTCGGGGCCGGCTTCTGCACCACCGTCATCGCCTCCCCTGTTGATGTGGTCAAGACGAGATACATGAACTCTGCCTTGGGCCAGTACCACAGCGCAGGTCACTGTGCCCTTACCATGCTCCGGAAGGAGGGACCCCGCGCCTTCTACAAGGGGTTCATGCCTTCCTTTCTCCGCTTGGGATCCTGGAACGTAGTGATGTTTGTCACCTATGAGCAGCTCAAAAGAGCCCTAATGGCTGCCTACCAATCTCGGGAGGCACCTTTCTGAGCCTCTCCATGCTGACCTGGACCCTGCTTCCCAGCCCTGCCCTGTCTTTTTCTTCATCCTCTGCCCAGTCCCATTCTCTTCCCATTTCCTGCAC

Ensembl | nº de acceso | ratón

ENSMUSG00000033685

Nº de acceso NCBI

NM_011671

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... UCP2(22228) , Ucp2(22228)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Emiko Kasahara et al.
Neuroimmunomodulation, 22(5), 279-292 (2015-06-16)
Although psychological and/or physiological stress has been well documented to influence immune responses, the precise mechanism for immunomodulation remains to be elucidated. The present work describes the role of the hypothalamic-pituitary-adrenal (HPA) axis in the mechanism of stress-mediated enhanced-resistance to
Guangsheng Yu et al.
Bioscience reports, 35(4) (2015-07-17)
Oxidative stress induction is a common effector pathway for commonly used chemotherapeutic agents like gemcitabine (GEM) in hepatocellular carcinoma (HCC) patients. However, GEM alone or in combination with oxiplatin hardly renders any survival benefits to HCC patients. Mitochondrial uncoupling protein

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico