Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU024081

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Trim28

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGATTCCCAGGATGCTAACCAGTGCTGCACTAGCTGTGAAGATAATGCCCCAGCCACTAGCTATTGTGTGGAGTGCTCTGAACCACTTTGTGAGACCTGTGTGGAGGCTCACCAGCGGGTGAAATACACCAAGGACCACACTGTGCGCTCCACAGGACCTGCTAAGACTCGAGATGGAGAGCGAACAGTCTACTGTAATGTGCACAAGCATGAGCCCCTCGTGCTGTTCTGTGAGAGCTGTGACACACTCACCTGCCGCGACTGCCAGCTCAACGCTCACAAGGACCATCAGTACCAGTTTTTGGAAGATGCAGTGAGGAACCAACGTAAACTCTTGGCTTCACTGGTGAAACGTCTTGGGGACAAACATGCCACACTTCAGAAAAACACCAAGGAGGTTCGAAGCTCGATCCGCCAGGTGTCTGATGTGCAGAAGCGAGTGCAGGTTGAT

Ensembl | nº de acceso | ratón

ENSMUSG00000005566

Nº de acceso NCBI

NM_011588

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... TRIM28(21849) , Trim28(21849)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

A Bakr et al.
Nucleic acids research, 43(6), 3154-3166 (2015-03-11)
Ataxia-telangiectasia mutated (ATM) is needed for the initiation of the double-strand break (DSB) repair by homologous recombination (HR). ATM triggers DSB end resection by stimulating the nucleolytic activity of CtIP and MRE11 to generate 3'-ssDNA overhangs, followed by RPA loading
Estela Cruvinel et al.
Human molecular genetics, 23(17), 4674-4685 (2014-04-25)
Prader-Willi syndrome (PWS), a disorder of genomic imprinting, is characterized by neonatal hypotonia, hypogonadism, small hands and feet, hyperphagia and obesity in adulthood. PWS results from the loss of paternal copies of the cluster of SNORD116 C/D box snoRNAs and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico