Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU022451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gata2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGGAACGCCAACGGGGACCCTGTGTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACCCGGAATCGGAAGATGTCCAGCAAATCCAAGAAGAGCAAGAAAGGGGCTGAATGTTTCGAGGAGCTCTCCAAGTGCATGCAAGAGAAGTCACCGCCCTTCAGTGCGGCTGCCCTGGCTGGACACATGGCACCTGTGGGACACCTCCCACCTTTTAGTCACTCTGGACACATCCTACCCACGCCCACGCCTATCCACCCTTCCTCCAGTCTCTCTTTTGGCCACCCCCACCCGTCCAGCATGGTGACTGCCATGGGCTAGGCAAGCCTCCCACTGGACAGACATGGACATCAAGGGTGGT

Ensembl | nº de acceso | ratón

ENSMUSG00000015053

Nº de acceso NCBI

NM_008090

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... GATA2(14461) , Gata2(14461)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XWR
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gaurang Trivedi et al.
Science translational medicine, 11(511) (2019-09-27)
Adult stem and progenitor cells are uniquely capable of self-renewal, and targeting this process represents a potential therapeutic opportunity. The early erythroid progenitor, burst-forming unit erythroid (BFU-E), has substantial self-renewal potential and serves as a key cell type for the
Song Shen et al.
Molecular pharmaceutics, 11(8), 2612-2622 (2014-02-14)
Synthetic lethal interaction provides a conceptual framework for the development of wiser cancer therapeutics. In this study, we exploited a therapeutic strategy based on the interaction between GATA binding protein 2 (GATA2) downregulation and the KRAS mutation status by delivering
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico