Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU021961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk14

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAGTGGAAGAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAAATGGAGTCCTGAGCACCTGGTTTCTGTTCTGTCTATCTCACTTCACTGTGAGGGGAAGACCTTCTCATGGGAACTCTCCAAATACCATTCAAGTGCCTCTTGTTGAAAGATTCCTTCATGGTGGAAGGGGGTGCATGTATGTGTTAGTGTTTGTGTGTGTGTGTGTGTCTGTCTGTTCGTCTGTCCACCTATCTTTGTGGAAGTCACTGTGATGGTAGTGACTTTATGAGTTGTGAATGGTCCTTGGCAGTCTGCCTGCTTTCTCAGAGTCTGGGCAGGCCGATGGGAACTGTCATCTCCTTAGGGATGTGTGTGTTCAGTGCAAAGTAAGAAATATGAAAATATCCCTGTTCTTAGTTACCTTGCCACTTTGGCTTC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hye Jeong Lee et al.
Molecular endocrinology (Baltimore, Md.), 29(6), 873-881 (2015-04-01)
Irisin is a novel myokine produced by skeletal muscle. However, its metabolic role is poorly understood. In the present study, irisin induced glucose uptake in differentiated skeletal muscle cells. It increased AMP-activated protein kinase (AMPK) phosphorylation and the inhibition of
Ana M Tormos et al.
PloS one, 12(2), e0171738-e0171738 (2017-02-07)
Hepatocyte poliploidization is an age-dependent process, being cytokinesis failure the main mechanism of polyploid hepatocyte formation. Our aim was to study the role of p38α MAPK in the regulation of actin cytoskeleton and cytokinesis in hepatocytes during development and aging.
Xiaoling Gu et al.
Free radical biology & medicine, 83, 149-158 (2015-03-17)
An increasing number of studies have focused on the phenomenon that mitochondrial DNA (mtDNA) activates innate immunity responses. However, the specific role of mtDNA in inflammatory lung disease remains elusive. This study was designed to examine the proinflammatory effects of
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Xi-Xi Lin et al.
Toxicology mechanisms and methods, 24(8), 575-583 (2014-08-20)
Cigarette smoke contains reactive oxygen (ROS) that can cause oxidative stress. It increases the number of apoptotic and necrotic lung cells and further induces the development of chronic airway disease. In this study, we investigated the effects of cigarette smoke

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico