Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU021811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fn1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTGCTTCATGCCGCTAGATGTGCAAGCTGACAGAGACGATTCTCGAGAGTAATCTTTCCAGCCCCACCCTACAAGTGTCTCTCTACCAAGGTCAATCCACACCCCAGTGATGTTAGCAGACCCTCCATCTTTGAGTGGTCCTTTCACCCTTAAGCCTTTTGCTCTGGAGCCATGTTCTCAGCTTCAGCACAATTTACAGCTTCTCCAAGCATCGCCCCGTGGGATGTTTTGAGACTTCTCTCCTCAATGGTGACAGTTGGTCACCCTGTTCTGCTTCAGGGTTTCAGTACTGCTCAGTGTTGTTTAAGAGAATCAAAAGTTCTTATGGTTTGGTCTGGGATCAATAGGGAAACACAGGTAGCCAACTAGGAGGAAATGTACTGAATGCTAGTACCCAAGACCTTGAGCAGGAAAGTCACCCAGACACCTCTGCTTTCTTTTGCC

Ensembl | nº de acceso | ratón

ENSMUSG00000026193

Nº de acceso NCBI

NM_010233

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... FN1(14268) , Fn1(14268)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenjian Wang et al.
Kidney international, 81(10), 1002-1014 (2012-03-02)
Scavenger receptor A (SR-A) is a key transmembrane receptor in the endocytosis of lipids and contributes to the pathogenesis of atherosclerosis. To assess its role in hyperlipidemic chronic kidney disease, wild-type and SR-A-deficient (knockout) mice underwent uninephrectomy followed by either
H W Zhang et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(2), 26-32 (2015-05-31)
Endothelial progenitor cells (EPCs) could function as niche cells to promote self—renewal of mesenchymal stem cells (MSCs) in the mouse bone marrow. Cohesion was the basis of the two cells to display their biological functions to each other. In this
Tong-Peng Xu et al.
Journal of hematology & oncology, 7, 63-63 (2014-08-30)
FENDRR is a long non-coding RNAs (lncRNA) that binds to polycomb repressive complexe 2 (PRC2) to epigenetically regulate the expression of its target gene. The clinical role of FENDRR in carcinomas remains yet to be found. Real-time polymerase chain reaction

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico