Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU021761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Slc25a28

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCCCACTGGACGTTTGTAAAACACTGCTCAACACCCAGGAATCCCTGGCTTTGAACTCAAACATTACTGGACACATCACAGGCATGGCTAGTGCCTTCAGGACGGTCTATCAAGTAGGCGGGGTGACTGCTTACTTCCGAGGGGTGCAGGCCAGAGTCATTTACCAGATCCCCTCCACAGCCATCGCATGGTCTGTGTATGAATTTTTCAAATACCTAATCACAAAGCGGCAAGAGGAATGGAGGGCAGGCAAGTGAAGGGATGCTGAGTGGACCAGGGTCCGACCGCACGGCTGCATCCTGCCCTTCCAGCACATTCTCTGGCTGCTGGCACACTCCAGTCTCAAGAGGAGTTGGAAGGAGGGAGAGAGCTTGCTCCAGGCTGTAGTTGGCTAACACTAGTTCTTGCCAACATCTGTCGCCACTGTTGTCTTTCTTCCTGGGC

Ensembl | nº de acceso | ratón

ENSMUSG00000040414

Nº de acceso NCBI

NM_145156

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SLC25A28(246696) , Slc25a28(246696)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2
Chunlei Wang et al.
European journal of medical research, 19, 49-49 (2014-09-27)
Among glioma treatment strategies, arsenic trioxide (As2O3) has shown efficacy as a therapeutic agent against human gliomas. However, the exact antitumor mechanism of action of As2O3 is still unclear. Mitochondria are considered to be the major source of intracellular reactive

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico