Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU021131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Notch4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGGAAGGAAGCGACACGTACGAGTCTGGAAGACTCCGGACTTTTAAGGCCAAAATAACCGTTAAGCTCACTTGTCTCCCCCATAGAGTATGCACAGCAATGGGAAGAGGGTTTAGGATGTCCGGTTGAGATAGACCGTGATTTTCCTGGAAAATAGGGCAGCTTCAAGAGGACAAAGTTGATTTCGAGAATCCCTAAACTCTGGAACCAAGAACTGTGGGCGAATTGGGTGTAAAATGTTTCTTGAGTATGGTTTCCCAAAAGGAGCCTCTGCTATCTACTGCCCACAAGTAGCTGGCAACTATTTATTAAGCACCTACGATGTGCCGGGTGTTGTGTAGATGATGAACAGTAACCAGTGGCCCATCCAGCTGATGACTCCTTGCCCTCTCTCTGCCTCCCCACAAGGACACTGGTGCAGGGATGAGGCCATGTTCTCCAGT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cui-Juan Qian et al.
Oncology letters, 12(5), 3499-3505 (2016-12-03)
Overexpression of Notch4 is associated with a variety of tumor types. Only sparse information exists on Notch4 expression in pancreatic cancer (PC). The present study demonstrated that Notch4 expression was significantly upregulated in PC cell lines compared with a non-transformed
Quyen Thu Bui et al.
Cancer letters, 390, 115-125 (2017-01-22)
We previously demonstrated that tamoxifen (TAM)-resistant human breast cancer (TAMR-MCF-7) cells showed increased expression of mesenchymal marker proteins compared to the parent MCF-7 cells. Notch is functionally important in the promotion of epithelial-mesenchymal transition (EMT) during both development and tumor

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico