Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU020171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tyms

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCCAGTTTATGGTTTCCAATGGAGGCATTTTGGAGCAGAGTACAAAGATATGGATTCAGATTACTCGGGACAAGGAGTAGACCAGCTGCAAAAAGTGATTGACACCATCAAAACCAACCCTGATGACAGAAGAATCATCATGTGTGCCTGGAACCCAAAAGATCTTCCCCTGATGGCACTGCCTCCTTGCCATGCCCTCTGTCAGTTCTATGTGGTGAATGGGGAACTGTCTTGCCAGCTTTACCAGAGGTCAGGAGATATGGGTCTGGGCGTGCCCTTCAACATTGCCAGCTATGCTCTGCTCACCTACATGATTGCACATATCACAGGCCTGCAGCCAGGTGATTTTGTCCACACTTTGGGAGATGCACATATTTACCTGAATCATATAGAGCCGCTGAAAATTCAGCTACAGCGAGAACCAAGACCTTTCCCAAAGC

Ensembl | nº de acceso | ratón

ENSMUSG00000025747

Nº de acceso NCBI

NM_021288

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... TYMS(22171) , Tyms(22171)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
P Svenningsen et al.
Acta physiologica (Oxford, England), 212(2), 166-174 (2014-06-11)
In the renal collecting ducts, ATP stimulates a Ca(2+) -activated chloride current. The identity of the channel responsible for the current under physiological conditions is not known and it was hypothesized that TMEM16a is a relevant candidate in the renal

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico