Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU014921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Parp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCATCAAGAATGAAGGAAAGAGAAAAGGTGACGAGGTGGATGGAACAGATGAAGTGGCCAAAAAGAAATCTAAGAAAGGGAAGGACAAGGATAGTAGTAAGCTGGAGAAGGCCCTCAAGGCTCAGAATGAGCTGATCTGGAATATCAAAGACGAGCTGAAGAAAGCGTGTTCCACCAACGACCTGAAGGAGCTGCTCATCTTCAACCAGCAGCAGGTGCCGTCAGGAGAGTCAGCGATCTTGGACAGAGTTGCTGACGGCATGGCGTTTGGGGCCCTTCTGCCCTGCAAGGAGTGTTCAGGCCAGCTGGTCTTTAAGAGCGACGCTTATTACTGTACTGGGGATGTCACTGCCTGGACCAAGTGCATGGTCAAGACACAGAATCCTAGCCGAAAGGAATGGGTAACTCCAAAGGAATTCCGAGAAA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Hui Peng et al.
PloS one, 10(5), e0125318-e0125318 (2015-05-21)
Microsomal epoxide hydrolase (mEH) is a bifunctional protein that plays a central role in the metabolism of numerous xenobiotics as well as mediating the sodium-dependent transport of bile acids into hepatocytes. These compounds are involved in cholesterol homeostasis, lipid digestion
Hyeon-Jun Shin et al.
Scientific reports, 5, 15798-15798 (2015-11-03)
Necrosis, unregulated cell death, is characterized by plasma membrane rupture as well as nuclear and cellular swelling. However, it has recently been reported that necrosis is a regulated form of cell death mediated by poly-(ADP-ribose) polymerase 1 (PARP1). PARP1 is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico