Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU014271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Smad3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATCCGTATGAGCTTCGTCAAAGGCTGGGGAGCAGAGTACAGGAGACAGACAGTGACCAGCACCCCCTGCTGGATTGAGCTACACCTGAATGGACCCTTGCAGTGGCTTGTCAAGGTCCTCACCCAGATGGGTTCCCCGAGCATCCGCTGTTCCAGTGTGTCTTAGAGACACTAGGAGTAAAGGGAGCGGGTTGGGGAGGGCGGGCTTGGGGAAAATGACCTTGGAAGAGAACTCCATCCAACTTGGTCTTGTCAAAGAACACCGATTCCACTCAACTAAGGCACCAGCCTGTTTCTGAGACCACAGAAGAAAACCCCAGGGATGGATTTATGAACAGCTGTGTCTGCTACATACACGTGCCCCTGTCTGAAGGCCAAGTGATGGCTTCTGTTCTGGTGGCTTGAACTAACAGGTGGTGTATCGCCA

Ensembl | nº de acceso | ratón

ENSMUSG00000032402

Nº de acceso NCBI

NM_016769

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... SMAD3(17127) , Smad3(17127)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tianli Cheng et al.
International journal of oncology, 45(5), 1977-1988 (2014-09-02)
Altered expression of miRNAs contributes to development and progression of non-small cell lung cancer (NSCLC), while transforming growth factor-β (TGF-β) promotes NSCLC cell epithelial-mesenchymal transition. This study aimed to investigate the effects of TGF-β-induced miR‑143 expression in regulation of NSCLC
A Sakoguchi et al.
Clinical and experimental rheumatology, 32(6 Suppl 86) (2014-06-25)
The toll-like receptor (TLR) family is thought to be expressed in many cell types in the skin and play a role in various diseases. The expression pattern and role of TLRs in systemic sclerosis (SSc) is to be clarified. We

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico