Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU012411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rab24

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTGACCTGCTGGAGGAAGACAGGCGGCGCCGTCGTGTAGACTTCCATGATGTTCAGGACTATGCCGATAATATCAAAGCCCAACTCTTTGAAACATCCAGCAAGACAGGCCAAAGTGTGGATGAACTCTTCCAGAAAGTGGCTGAGGATTACGTCAGTGTGGCTGCTTTCCAGGTGATGACAGAGGACAAAGGTGTGGATTTGAGCCAGAAGGCAAACCCTTACTTCTACAGCTGTTGTCATCACTGAGTCACCAGTCATCTGGCCCAGTGGAATTAGATGAATTCCCAGAGGGGCTGGACCTGACTCTTGTCTGGGCTGGAATGGTCAAGCGTCTGAGCTATTCCAGGTGCCTCTCACAGCAGAGGTGGCACCTGCCTGTGCTGGCCCATGGAACGGAGGCAGTATTGGGCTGACTGTGGG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Celina Amaya et al.
Traffic (Copenhagen, Denmark), 17(11), 1181-1196 (2016-10-27)
Endocytosis is a multistep process engaged in extracellular molecules internalization. Several proteins including the Rab GTPases family coordinate the endocytic pathway. The small GTPase Rab7 is present in late endosome (LE) compartments being a marker of endosome maturation. The Rab
Päivi Ylä-Anttila et al.
Autophagy, 11(10), 1833-1848 (2015-09-02)
RAB24 belongs to a family of small GTPases and has been implicated to function in autophagy. Here we confirm the intracellular localization of RAB24 to autophagic vacuoles with immuno electron microscopy and cell fractionation, and show that prenylation and guanine

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico