Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU006911

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lgals3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATCACAATCATGGGCACAGTGAAACCCAACGCAAACAGGATTGTTCTAGATTTCAGGAGAGGGAATGATGTTGCCTTCCACTTTAACCCCCGCTTCAATGAGAACAACAGGAGAGTCATTGTGTGTAACACGAAGCAGGACAATAACTGGGGAAAGGAAGAAAGACAGTCAGCCTTCCCCTTTGAGAGTGGCAAACCATTCAAAATACAAGTCCTGGTTGAAGCTGACCACTTCAAGGTTGCGGTCAACGATGCTCACCTACTGCAGTACAACCATCGGATGAAGAACCTCCGGGAAATCAGCCAACTGGGGATCAGTGGTGACATAACCCTCACCAGCGCTAACCACGCCATGATCTAAGCCAGAAGGGGCGGCACCGAAACCGGCCCTGTGTGCCTTAGGAGTGGGAA

Ensembl | nº de acceso | ratón

ENSMUSG00000050335

Nº de acceso NCBI

NM_010705

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... LGALS3(16854) , Lgals3(16854)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rafael Yamashita Ikemori et al.
PloS one, 9(11), e111592-e111592 (2014-11-05)
Galectin-3 (gal-3) is a β-galactoside binding protein related to many tumoral aspects, e.g. angiogenesis, cell growth and motility and resistance to cell death. Evidence has shown its upregulation upon hypoxia, a common feature in solid tumors such as glioblastoma multiformes
Lili Qiao et al.
Molecular medicine reports, 13(1), 160-166 (2016-01-01)
Galectin-3 is a multifunctional β-galactoside‑binding lectin that is involved in multiple biological functions which are upregulated in malignancies, including cell growth, adhesion, proliferation, progression and metastasis, as well as apoptosis. A previous study has confirmed the roles of galecin-3 overexpression
Junxiu Liu et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 30(6), 461-465 (2014-03-22)
Vascular endothelial growth factor C (VEGF-C) promotes cervical cancer metastasis, while the detailed mechanism remains obscure. Recent evidence shows that galectin-3 (Gal-3), a glycan binding protein, interacts with the VEGF receptors and reinforces their signal transduction. In this study, we
D Zhu et al.
Leukemia, 29(7), 1587-1599 (2015-02-14)
The pathogenesis of Chlamydophila psittaci-negative ocular adnexal extranodal marginal zone lymphomas (OAEMZLs) is poorly understood. OAEMZLs are monoclonal tumors expressing a biased repertoire of mutated surface immunoglobulins. Antigenic activation of the B-cell receptor (BCR) may have a role in the
Sonja Aits et al.
Autophagy, 11(8), 1408-1424 (2015-06-27)
Lysosomal membrane permeabilization (LMP) contributes to tissue involution, degenerative diseases, and cancer therapy. Its investigation has, however, been hindered by the lack of sensitive methods. Here, we characterize and validate the detection of galectin puncta at leaky lysosomes as a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico