Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU006511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dync2li1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACTACGGAGCCTCGCTGATGTTTACCAGCAAGTCAGAAGCTCTGTTACTGAAGATACGCGGTGTTATCAACCAGTTGGCATTCGGTATTGATAAAAGCAAATCAATATGTGTGGATCAAAATAAGCCACTGTTTATCACAGCAGGACTGGATTCTTTATGTCAGATAGGGTCTCCTCCTGTTCCTGACAGTGACATTGGAAAACTTCAGGCCCACTCACCTATGGAGCTGTGGAAAAAGGTGTATGACAAGCTCTTCCCACCAAAGAGTACCGGCACCCTGAAGGCGGTCCAGGACCCAGCCCGAGACCCGCAGTATGCAGAAAGCGAAGTCGATGAGATGAGGGTTCAGAAGGACCAGGAACTAGAACACTACAAGAGAAGCTCCTCTAAGACCTGGAAGCAAATCGA

Ensembl | nº de acceso | ratón

ENSMUSG00000024253

Nº de acceso NCBI

NM_172256

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... DYNC2LI1(213575) , Dync2li1(213575)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kristin Kessler et al.
Scientific reports, 5, 11649-11649 (2015-07-02)
Skeletal ciliopathies are a heterogeneous group of autosomal recessive osteochondrodysplasias caused by defects in formation, maintenance and function of the primary cilium. Mutations in the underlying genes affect the molecular motors, intraflagellar transport complexes (IFT), or the basal body. The
S Paige Taylor et al.
Nature communications, 6, 7092-7092 (2015-06-17)
The short rib polydactyly syndromes (SRPSs) are a heterogeneous group of autosomal recessive, perinatal lethal skeletal disorders characterized primarily by short, horizontal ribs, short limbs and polydactyly. Mutations in several genes affecting intraflagellar transport (IFT) cause SRPS but they do

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico