Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU005581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Timp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGAATCAACGAGACCACCTTATACCAGCGTTATAAGATCAAGATGATGACTAAGATGCTAAAAGGATTCAAGGCTGTGGGAAATGCCGCAGATATCCGGTACGCCTACACCCCAGTCATGGAAAGCCTCTGTGGATATGCCCACAAGTCCCAGAACCGCAGTGAAGAGTTTCTCATCACGGGCCGCCTAAGGAACGGGAAATTTCACATCAATGCCTGCAGCTTCTTGGTTCCCTGGCGTACTCTGAGCCCTGCTCAGCAAAGAGTTTTCTCAAAAAAGAACTATAGTGCTGGCTGTGGGGTGTGCACAGTGTTTCCCTGTTTATCTATCCCTTGCAAACTGGAGAGTGACACTCACTGTTTGTGGACGGATCAGGTCCTCGTGGGCTCTGAGGACTACCAGAGCCGTC

Ensembl | nº de acceso | ratón

ENSMUSG00000001131

Nº de acceso NCBI

NP_001037849

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... Timp1(21857)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiujuan Yao et al.
Respirology (Carlton, Vic.), 20(5), 730-738 (2015-05-02)
Interleukin (IL)-25 has been implicated in the pathogenesis of human asthma by inducing a Th2 cytokine response, but its possible role in the development of airway remodelling is less clear. We developed a murine surrogate of chronic airway inflammation induced
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Robert Ramer et al.
Biochemical pharmacology, 91(2), 202-216 (2014-07-01)
Cannabinoids inhibit tumor neovascularization as part of their tumorregressive action. However, the underlying mechanism is still under debate. In the present study the impact of cannabinoids on potential tumor-to-endothelial cell communication conferring anti-angiogenesis was studied. Cellular behavior of human umbilical

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico