Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU003111

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ihh

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCTAACCACTGCCCTCCTGGAACTGCTGTGCTGGATCCAAAGGCCTCCTCACCAGGAAGGCTCTGGCCCTGGAAGGCACCTGGCCTGAGGTTGTCTCCGTCCTCTGTGCCAGAGTGGAGACACCATTGAGACTTGACCAGGTTTGCTGGGCCCCGAACCTTCATCTTGGTGTAGAGCTGTGAACTGAGCTGACAAGCGTGTGGTAGGCTCTCTTTTCCTAGAGACCGTAAGACCCAGCTAGCTCTGGCTGCGATTCTTCACACGCATTCCATCTGTCTTTGGACTGCTTACTCCAATGTTTCTCGGGGCCTGGGATTGTGACTTTACTGTTGGCAACTGATCACAGTATGAAGAGAGGCTGCCCGTAGATGGGCTTGCACCTCAGTCGATGCTGCTAGATTCCC

Ensembl | nº de acceso | ratón

ENSMUSG00000006538

Nº de acceso NCBI

NM_010544

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... IHH(16147) , Ihh(16147)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ang Deng et al.
Experimental and therapeutic medicine, 15(1), 789-794 (2018-02-13)
The proliferative rate of chondrocytes affects bone elongation. Chondrocyte hypertrophy is required for endochondral bone formation as chondrocytes secrete factors required for osteoblast differentiation and maturation. Previous studies have demonstrated that the Indian hedgehog (Ihh) signaling pathway is a key
Shaowei Wang et al.
European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society, 24(8), 1720-1728 (2015-05-11)
To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico