Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU003031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xiap

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCGGGAGCAGCTATCTATCACTTGAGGTCCTGATTGCAGATCTTGTGAGTGCTCAGAAAGATAATACGGAGGATGAGTCAAGTCAAACTTCATTGCAGAAAGACATTAGTACTGAAGAGCAGCTAAGGCGCCTACAAGAGGAGAAGCTTTCCAAAATCTGTATGGATAGAAATATTGCTATCGTTTTTTTTCCTTGTGGACATCTGGCCACTTGTAAACAGTGTGCAGAAGCAGTTGACAAATGTCCCATGTGCTACACCGTCATTACGTTCAACCAAAAAATTTTTATGTCTTAGTGGGGCACCACATGTTATGTTCTTCTTGCTCTAATTGAATGTGTAATGGGAGCGAACTTTAAGTAATCCTGCATTTGCATTCCATTAGCATCCTGCTGTTTCCAAATGG

Ensembl | nº de acceso | ratón

ENSMUSG00000025860

Nº de acceso NCBI

NP_033818

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... Xiap(11798)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anak A S S K Dharmapatni et al.
Mediators of inflammation, 2015, 564042-564042 (2015-09-09)
To investigate the effect of Embelin, an inhibitor of X-Linked Inhibitor of Apoptosis Protein (XIAP), on inflammation and bone erosion in a collagen antibody induced arthritis (CAIA) in mice. Four groups of mice (n = 6 per group) were allocated:
N Raulf et al.
British journal of cancer, 111(10), 1955-1964 (2014-10-15)
Current treatment strategies for head and neck cancer are associated with significant morbidity and up to 50% of patients relapse, highlighting the need for more specific and effective therapeutics. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) and Smac mimetics (SMs) are
Azhar R Hussain et al.
The Journal of clinical endocrinology and metabolism, 100(7), E974-E985 (2015-05-15)
Papillary thyroid cancer (PTC) is the second most common cancer in females in Saudi Arabia. However, the pathogenesis of PTC is still not fully elucidated. To identify potential genes that play important role in progression of PTC, we studied the
Sojung Park et al.
Anticancer research, 34(7), 3557-3562 (2014-07-02)
Despite the selectivity of Tumor necrosis factor Related Apoptosis-Inducing Ligand (TRAIL) for cancer cell killing activity, breast cancer cells are resistant to TRAIL-induced apoptosis for various reasons. From a functionally-characterized small-molecule dataset, CGP74514A was identified as a TRAIL sensitizer in
Cheng-Yu Tsai et al.
Metallomics : integrated biometal science, 7(11), 1477-1487 (2015-07-25)
Mammalian cells have two influx Cu transporters that form trimers in membranes. CTR1 is the high affinity transporter that resides largely in the plasma membrane, and CTR2 is the low affinity transporter that is primarily associated with vesicular structures inside

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico