Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU001801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tert

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTGGTGAACTTCCCTGTGGAGCCTGGTACCCTGGGTGGTGCAGCTCCATACCAGCTGCCTGCTCACTGCCTGTTTCCCTGGTGTGGCTTGCTGCTGGACACTCAGACTTTGGAGGTGTTCTGTGACTACTCAGGTTATGCCCAGACCTCAATTAAGACGAGCCTCACCTTCCAGAGTGTCTTCAAAGCTGGGAAGACCATGCGGAACAAGCTCCTGTCGGTCTTGCGGTTGAAGTGTCACGGTCTATTTCTAGACTTGCAGGTGAACAGCCTCCAGACAGTCTGCATCAATATATACAAGATCTTCCTGCTTCAGGCCTACAGGTTCCATGCATGTGTGATTCAGCTTCCCTTTGACCAGCGTGTTAGGAAGAACCTCACATTCTTTCTGGGCATCATCTCC

Ensembl | nº de acceso | ratón

ENSMUSG00000021611

Nº de acceso NCBI

NM_009354

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... TERT(21752) , Tert(21752)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ki Chan Kim et al.
Molecular neurobiology, 53(10), 7312-7328 (2015-12-24)
In addition to its classical role as a regulator of telomere length, recent reports suggest that telomerase reverse transcriptase (TERT) plays a role in the transcriptional regulation of gene expression such as β-catenin-responsive pathways. Silencing or over-expression of TERT in
T Liu et al.
British journal of cancer, 108(11), 2272-2280 (2013-05-18)
Telomerase and telomerase reverse transcriptase (hTERT) confer cancer cells sustained proliferation and survival potentials. Targeting telomerase or hTERT is a novel anti-cancer strategy. However, telomerase/hTERT inhibition alone has minimal clinical efficacy. We explored the relationship between hTERT and cyclooxygenase 2
Xin Tian et al.
Evidence-based complementary and alternative medicine : eCAM, 2015, 546210-546210 (2016-01-20)
Bufalin, a digoxin-like active component of the traditional Chinese medicine Chan Su, exhibits potent antitumor activities in many human cancers. Bufalin induces mitochondria-dependent apoptosis in cancer cells, but the detailed molecular mechanisms are largely unknown. hTERT, the catalytic subunit of
Zhiping Liu et al.
PloS one, 8(1), e53576-e53576 (2013-01-18)
Our previous work had found that telomerase rejuvenated in the cytoplasm of corneal epithelial cells cultured in embryonic stem cell-conditioned medium, the functional properties of stem-like corneal epithelial cells can be enhanced by co-culturing with embryonic stem cells (ESCs) via
Lei Wang et al.
Journal of biomedical nanotechnology, 11(9), 1653-1661 (2015-10-22)
Current diagnostic techniques do not reliably detect cancer at early stages, and traditional chemotherapy lacks specificity and causes systemic toxicity. To address these issues, multifunctional nanomaterials are becoming more widely studied as a means of cancer detection, therapy, and monitoring.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico