Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU225871

Sigma-Aldrich

MISSION® esiRNA

targeting human UGT1A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTTTTTGTTGGTGGAATCAACTGCCTTCACCAAAATCCACTATCCCAGGAATTTGAAGCCTACATTAATGCTTCTGGAGAACATGGAATTGTGGTTTTCTCTTTGGGATCAATGGTCTCAGAAATTCCAGAGAAGAAAGCTATGGCAATTGCTGATGCTTTGGGCAAAATCCCTCAGACAGTCCTGTGGCGGTACACTGGAACCCGACCATCGAATCTTGCGAACAACACGATACTTGTTAAGTGGCTACCCCAAAACGATCTGCTTGGTCACCCGATGACCCGTGCCTTTATCACCCATGCTGGTTCCCATGGTGTTTATGAAAGCATATGCAATGGCGTTCCCATGGTGATGATGCCCTTGTTTGGTGATCAGATGGACAATGCAAAGCGCATGGAGACTAAGGGAGCTGGAGTGACCCTGAATGTTCTGGAAATGACTTCTGAAGATTTAGAAAATGCTCTAAAAGCAGTCATCAATGACAAAAGTTACAAGGAGAACATCATGCGC

Ensembl | nº de acceso humano

ENSG00000241635

Nº de acceso NCBI

NM_000463

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... UGT1A1(54575) , UGT1A1(54658)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

S C Williamson et al.
British journal of cancer, 109(4), 950-956 (2013-07-25)
Evidence increasingly supports that prostate cancer is initiated by the malignant transformation of stem cells (SCs). Furthermore, many SC-signalling pathways are shown to be shared in prostate cancer. Therefore, we planned transcriptome characterisation of adult prostate SCs as a strategy
Huiying Liu et al.
PloS one, 10(2), e0117051-e0117051 (2015-02-19)
β-lapachone (β-lap), an quinone oxidoreductase 1 (NQO1) targeting antitumor drug candidate in phase II clinical trials, is metabolically eliminated via NQO1 mediated quinone reduction and subsequent UDP-glucuronosyltransferases (UGTs) catalyzed glucuronidation. This study intends to explore the inner link between the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico