Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU157231

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCTTCATGGACGGCTACACAGGAGAGTTTGACACCTTCCTCTACCAGCTGCCAGGAACAGTCCAGCCATGCTCCTCAGCCTCCTCCTCGGCCTCCTCCACATCCTCGTCCTCAGCCACCTCCCCTGCCTCTGCCTCCTTCAAGTTCGAGGACTTCCAGGTGTACGGCTGCTACCCCGGCCCCCTGAGCGGCCCAGTGGATGAGGCCCTGTCCTCCAGTGGCTCTGACTACTATGGCAGCCCCTGCTCGGCCCCGTCGCCCTCCACGCCCAGCTTCCAGCCGCCCCAGCTCTCTCCCTGGGATGGCTCCTTCGGCCACTTCTCGCCCAGCCAGACTTACGAAGGCCTGCGGGCATGGACAGAGCAGCTGCCCAAAGCCTCTGGGCCCCCACAGCCTCCAGCCTTCTTTTCCTTCA

Ensembl | nº de acceso humano

ENSG00000123358

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NR4A1(3164) , NR4A1(3164)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
SWS
WNS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hiroki Maruoka et al.
Scientific reports, 10(1), 6325-6325 (2020-04-15)
Forskolin promotes neuronal differentiation of PC12 cells via the PKA-CREB-dependent signaling pathway. Activation of PKA by forskolin phosphorylates CREB, which then binds to CRE sites in numerous gene promoters. However, it is unclear which gene contains the CRE sites responsible
Meihui Huang et al.
Journal of Cancer, 10(15), 3560-3570 (2019-07-12)
NR4A1 acts as an oncogene and plays an important role in colorectal cancer development and progression, but little is known about the regulatory mechanism of NR4A1 expression. MicroRNA (miRNA) is involved in the progression of various tumors, affecting proliferation, apoptosis
Bin Huang et al.
Scientific reports, 8(1), 13895-13895 (2018-09-19)
Nur77 is a member of the NR4A subfamily of nuclear receptors and has been shown to regulate various biological processes such as apoptosis and inflammation. Here, we show that Nur77 ubiquitination is mediated by the tripartite motif 13 (Trim13), a
Mei Ha et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(6), 2029-2045 (2018-11-12)
Triclosan (TCS), a broad-spectrum antibacterial and antifungal compound and an endocrine disruptor, has anti-androgenic properties and could adversely affect male reproduction and fertility. To elucidate the underlying roles of miRNAs and the MAPK pathway in TCS-mediated repression of testicular steroidogenesis
Xina Xie et al.
Clinical science (London, England : 1979), 129(12), 1151-1161 (2015-09-24)
Hypercholesterolaemia and inflammation are correlated with atherogenesis. Orphan nuclear receptor NR4A1, as a key regulator of inflammation, is closely associated with lipid levels in vivo. However, the mechanism by which lipids regulate NR4A1 expression remains unknown. We aimed to elucidate the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico