Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU151981

Sigma-Aldrich

MISSION® esiRNA

targeting human HIF1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTGAAACTCAAGC

Ensembl | nº de acceso humano

ENSG00000100644

Nº de acceso NCBI

NM_001530

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HIF1A(3091) , HIF1A(3091)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shu Lou et al.
Frontiers in cell and developmental biology, 8, 576-576 (2020-08-09)
Although genetic variants in autophagy pathway genes were associated with the risk of oral cancers and early development in embryos, their associations with non-syndromic cleft lip with or without cleft palate (NSCL/P) risk remained unclear. A two-stage case-control study (2,027
Klaartje Somers et al.
Oncogene, 38(20), 3824-3842 (2019-01-24)
Survival rates for pediatric patients suffering from mixed lineage leukemia (MLL)-rearranged leukemia remain below 50% and more targeted, less toxic therapies are urgently needed. A screening method optimized to discover cytotoxic compounds selective for MLL-rearranged leukemia identified CCI-006 as a
Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Matilda Munksgaard Thorén et al.
Oncotarget, 8(30), 48983-48995 (2017-04-22)
We previously demonstrated that small cell lung carcinoma (SCLC) cells lack HIF-2α protein expression, whereas HIF-1α in these cells is expressed at both acute and prolonged hypoxia. Here we show that low HIF2A expression correlates with high expression of MYC
Olga Roche et al.
Nucleic acids research, 44(19), 9315-9330 (2016-11-02)
A wide range of diseases course with an unbalance between the consumption of oxygen by tissues and its supply. This situation triggers a transcriptional response, mediated by the hypoxia inducible factors (HIFs), that aims to restore oxygen homeostasis. Little is
Ver todos los artículos relacionados

Protocolos

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico