Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU151881

Sigma-Aldrich

MISSION® esiRNA

targeting human SCN5A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAACGCCTTGTATGTCCTCAGTCCCTTCCACCCCATCCGGAGAGCGGCTGTGAAGATTCTGCTTTCCTTGACCCCACGCACGCTCTTCAACATGCTCATCATGTGCACCATCCTCACCAACTGCGTGTTCATGGCCCAGCACGACCCTCCACCCTGGACCAAGTATGTCGAGTACACCTTCACCGCCATTTACACCTTTGAGTCTCTGGTCAAGATTCTGGCTCGAGGCTTCTGCCTGCACGCGTTCACTTTCCTTCGGGACCCATGGAACTGGCTGGACTTTAGTGTGATTATCATGGCATACACAACTGAATTTGTGGACCTGGGCAATGTCTCAGCCTTACGCACCTTCCGAGTCCTCCGGGCCCTGAAAACTATATCAGTCATTTCAGGGCTGAAGACCATCGTGGGGGCCCTGATCCAGTCTGTGAAGAAGCTGGCTGATG

Ensembl | nº de acceso humano

ENSG00000183873

Nº de acceso NCBI

NM_000335

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SCN5A(6331) , SCN5A(6331)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
WNS
QCS
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wan-Lin Lo et al.
Nature immunology, 13(9), 880-887 (2012-07-31)
The sustained entry of Ca(2+) into CD4(+)CD8(+) double-positive thymocytes is required for positive selection. Here we identified a voltage-gated Na(+) channel (VGSC) that was essential for positive selection of CD4(+) T cells. Pharmacological inhibition of VGSC activity inhibited the sustained
Jie Zhang et al.
Acta biochimica et biophysica Sinica, 51(6), 562-570 (2019-05-30)
The protein voltage-gated sodium channel Nav1.5 is highly upregulated in various types of cancer and, in general, promotes cancer cell invasiveness and metastatic progression. A previous study found that Nav1.5 was highly expressed in poorly differentiated oral squamous cell carcinoma
Ming Yang et al.
Journal of cellular physiology, 235(4), 3950-3972 (2019-10-16)
Ion channels can regulate the plasma membrane potential (Vm ) and cell migration as a result of altered ion flux. However, the mechanism by which Vm regulates motility remains unclear. Here, we show that the Nav 1.5 sodium channel carries

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico