EHU150571
MISSION® esiRNA
targeting human XPNPEP2
About This Item
Productos recomendados
descripción
Powered by Eupheria Biotech
Nivel de calidad
Línea del producto
MISSION®
Formulario
lyophilized powder
secuencia objetivo ADNc esiRNA
TTATGATCTGGCCCTCCAAGGCTCTAACAGACAGCTGGTGTCCATCACAACCAATCTTGTGGACCTGGTATGGGGATCAGAGAGGCCACCGGTTCCAAATCAACCCATTTATGCCCTGCAGGAGGCATTCACAGGGAGCACTTGGCAGGAGAAAGTATCTGGCGTCCGAAGCCAGATGCAGAAGCATCAAAAGGTCCCGACTGCCGTCCTTCTGTCGGCGCTTGAGGAGACGGCCTGGCTCTTCAACCTTCGAGCCAGTGACATCCCCTATAACCCCTTCTTCTATTCCTACACGCTGCTCACAGACTCTTCTATTAGGTTGTTTGCAAACAAGAGTCGCTTTAGCTCCGAAACCTTGAGCTATCTGAACTCCAGTTGCACAGGCCCCATGTGTGTGCAAATCGAGGAT
Ensembl | nº de acceso humano
Nº de acceso NCBI
Condiciones de envío
ambient
temp. de almacenamiento
−20°C
Información sobre el gen
human ... XPNPEP2(7512) , XPNPEP2(7512)
Categorías relacionadas
Descripción general
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Información legal
Código de clase de almacenamiento
10 - Combustible liquids
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
Certificados de análisis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Si necesita más asistencia, póngase en contacto con Atención al cliente
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Protocolos
Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico