Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU150531

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC29A4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTGCCATACAACAGCTTCATCACGGACGTGGACTACCTGCATCACAAGTACCCAGGGACCTCCATCGTGTTTGACATGAGCCTCACCTACATCTTGGTGGCACTGGCAGCTGTCCTCCTGAACAACGTCCTGGTGGAGAGACTGACCCTGCACACCAGGATCACCGCAGGCTACCTCTTAGCCTTGGGCCCTCTCCTTTTTATCAGCATCTGCGACGTGTGGCTGCAGCTCTTCTCTCGGGACCAGGCCTACGCCATCAACCTGGCCGCTGTGGGCACCGTGGCCTTCGGCTGCACAGTGCAGCAATCCAGCTTCTACGGGTACACGGGGATGCTGCCCAAGCGGTACACGCAGGGGGTGATGACCGGGGAGAGCACGGCGGGCGTGATGATCTCTCTGAGCCGCAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Asmita Gyawali et al.
Biomolecules & therapeutics, 27(3), 290-301 (2019-04-12)
Paeonol has neuroprotective function, which could be useful for improving central nervous system disorder. The purpose of this study was to characterize the functional mechanism involved in brain transport of paeonol through blood-brain barrier (BBB). Brain transport of paeonol was
Jiaojiao Cong et al.
Journal of ethnopharmacology, 252, 112581-112581 (2020-01-23)
The herbs of Aconitum are the essential Traditional Chinese medicine and have played an indispensable role in many Asian countries for thousands of years to treat critical illnesses, and chronic, stubborn diseases. However, Aconitum may induce severe neurotoxicity and even

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico