Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU149571

Sigma-Aldrich

MISSION® esiRNA

targeting human MUC4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTCAGATGCGATGGCTACAAGGGCTACGACCTGGTCTACAGCCCCCAGAGCGGCTTCACCTGCGTGTCCCCGTGCAGTAGGGGCTACTGTGACCATGGAGGCCAGTGCCAGCACCTGCCCAGTGGGCCCCGCTGCAGCTGTGTGTCCTTCTCCATCTACACGGCCTGGGGCGAGCACTGTGAGCACCTGAGCATGAAAC

Ensembl | nº de acceso humano

ENSG00000145113

Nº de acceso NCBI

NM_004532

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MUC4(4585) , MUC4(4585)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
LCS
BXR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dongkui Xu et al.
Biochemical and biophysical research communications, 485(2), 556-562 (2016-12-08)
The dysregulated molecules and their involvement in lymph node metastases of cervical cancer are far from been fully revealed. In this study, by reviewing MUC4 expression in The Human Protein Atlas and retrieving gene microarray data in GEO dataset (No.
Se-Ra Lee et al.
International journal of molecular sciences, 20(11) (2019-05-31)
Tristetraprolin (TTP), a well-characterized AU-rich element (ARE) binding protein, functions as a tumor suppressor gene. The purpose of this study was to investigate whether a bioactive substance derived from a natural medicinal plant affects the induction of TTP and to
Lu-Yan Shen et al.
Oncotarget, 7(4), 4531-4541 (2015-12-18)
Heterogeneous efficacy of neoadjuvant chemotherapy has led to controversies that have limited its application in clinical practice. Thus, we aimed to identify potential biomarkers predicting esophageal squamous cell carcinoma (ESCC) chemo-responsiveness by gene expression profiling. CCK8 assay was used to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico