Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU146741

Sigma-Aldrich

MISSION® esiRNA

targeting human GAPDH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACA

Ensembl | nº de acceso humano

ENSG00000111640

Nº de acceso NCBI

NM_002046

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GAPDH(2597) , GAPDH(2597)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

R G Morgan et al.
Scientific reports, 8(1), 7952-7952 (2018-05-23)
3D tissue culture provides a physiologically relevant and genetically tractable system for studying normal and malignant human tissues. Despite this, gene-silencing studies using siRNA has proved difficult. In this study, we have identified a cause for why traditional siRNA transfection
Annalucia Carbone et al.
Stem cells international, 2018, 1203717-1203717 (2018-03-14)
We previously found that human amniotic mesenchymal stem cells (hAMSCs) in coculture with CF immortalised airway epithelial cells (CFBE41o- line, CFBE) on Transwell® filters acquired an epithelial phenotype and led to the expression of a mature and functional CFTR protein.
Suzan Ruijtenberg et al.
Nature structural & molecular biology, 27(9), 790-801 (2020-07-15)
Small interfering RNAs (siRNAs) promote RNA degradation in a variety of processes and have important clinical applications. siRNAs direct cleavage of target RNAs by guiding Argonaute2 (AGO2) to its target site. Target site accessibility is critical for AGO2-target interactions, but
Alan J Hibbitts et al.
Nanomaterials (Basel, Switzerland), 10(7) (2020-07-02)
Inhalation offers a means of rapid, local delivery of siRNA to treat a range of autoimmune or inflammatory respiratory conditions. This work investigated the potential of a linear 10 kDa Poly(ethylene glycol) (PEG)-modified 25 kDa branched polyethyleneimine (PEI) (PEI-LPEG) to
Fabienne Wagner et al.
PloS one, 14(10), e0218303-e0218303 (2019-10-24)
Cristae architecture is important for the function of mitochondria, the organelles that play the central role in many cellular processes. The mitochondrial contact site and cristae organizing system (MICOS) together with the sorting and assembly machinery (SAM) forms the mitochondrial
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico