Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU146511

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTATGGGCTACCAGCTGCATGGAGCAGAGGTGAACGGTGGGCTCCCATCTGCATCCTCCTTCTCCTCAGCCCCCGGAGCCACGTACGGCGGCGTCTCCAGCCACACGCCGCCTGTCAGCGGGGCCGACAGCCTCCTGGGCTCCCGAGGGACCACAGCTGGCAGCTCCGGGGATGCCCTCGGCAAAGCACTGGCCTCGATCTACTCCCCGGATCACTCAAGCAATAACTTCTCGTCCAGCCCTTCTACCCCCGTGGGCTCCCCCCAGGGCCTGGCAGGAACGTCACAGTGGCCTCGAGCAGGAGCCCCCGGTGCCTTATCGCCCAGCTACGAC

Ensembl | nº de acceso humano

ENSG00000071564

Nº de acceso NCBI

NM_001136139

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TCF3(6929) , TCF3(6929)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Indira Tiwari et al.
Cancer letters, 362(1), 131-138 (2015-03-31)
Downregulation of E-cadherin is a hallmark of epithelial-mesenchymal transition (EMT), an essential component of cancer progression to more aggressive phenotypes characterized by tumor dedifferentiation, infiltration, and metastasis. However, the underlying mechanism for E-cadherin downregulation in hepatitis C virus (HCV)-associated hepatocellular
Atsushi Kuwahara et al.
PloS one, 9(5), e94408-e94408 (2014-05-17)
During mouse neocortical development, the Wnt-β-catenin signaling pathway plays essential roles in various phenomena including neuronal differentiation and proliferation of neural precursor cells (NPCs). Production of the appropriate number of neurons without depletion of the NPC population requires precise regulation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico