Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU145411

Sigma-Aldrich

MISSION® esiRNA

targeting human MRGPRX2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGCCAACCCCATCATTTACTTCTTCGTGGGCTCTTTTAGGAAGCAGTGGCGGCTGCAGCAGCCGATCCTCAAGCTGGCTCTCCAGAGGGCTCTGCAGGACATTGCTGAGGTGGATCACAGTGAAGGATGCTTCCGTCAGGGCACCCCGGAGATGTCGAGAAGCAGTCTGGTGTAGAGATGGACAGCCTCTACTTCCATCAGATATATGTGGCTTTGAGAGGCAACTTTGCCCCTGTCTGTCTGATTTGCTGAACTTTCTCAGTCCTGATTTTAAAACAGTTAAGAGAGTCCTTGTGAGGATTAAGTGAGACAGTGCCTATGAAACAAACACTAAGTGCAGTGTCTCTGGAACTGCCTTACTCACAGGCTTCCACCACAGCCCTATGAGAGCTTTGCCAA

Ensembl | nº de acceso humano

ENSG00000183695

Nº de acceso NCBI

NM_054030

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MRGPRX2(117194) , MRGPRX2(117194)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yingzhuan Zhan et al.
Chemico-biological interactions, 308, 304-311 (2019-05-28)
Polymyxin B (PMB) and polymyxin E (PME) are cyclic, peptide antibiotics which derived from various species of Paenibacillus (Bacillus) polymyxa. They are decapeptide antibiotics with an antimicrobial spectrum that includes Gram-negative bacteria, and reused as therapeutic agents due to the
Ibrahim Alkanfari et al.
Cells, 8(4) (2019-04-17)
Host-defense peptides (HDPs) have an important therapeutic potential against microbial infections but their metabolic instability and cellular cytotoxicity have limited their utility. To overcome these limitations, we utilized five small-molecule, nonpeptide HDP mimetics (smHDPMs) and tested their effects on cytotoxicity
Yuanyuan Lin et al.
Journal of separation science, 41(11), 2488-2497 (2018-03-02)
Adverse drug reactions of Danshen injection mainly manifested as pseudoallergic reactions. In the present study, salvianolic acid A and a pair of geometric isomers (isosalvianolic acid C and salvianolic acid C) were identified as pseudoallergic components in Danshen injection by

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico