Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU140621

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTCAGTTGGGCCTTCATAAACACTCACCTGGCTGGCTTTGCCTTCCAGGAGGAAGCTGGCTGAAGCAAGGGTGTGGAATTTTAAATGTGTGCACAGTCTGGAAAACTGTCAGAATCAGTTTTCCCATAAAAGGGTGGGCTAGCATTGCAGCTGCATTTGGGACCATTCAAATCTGTCACTCTCTTGTGTATATTCCTGTGCTATTAAATATATCAGGGCAGTGCATGTAAATCATCCTGATATATTTAATATATTTATTATATTGTCCCCCGAGGTGGGGACAGTGAGTGAGTTCTCTTAGTCCCCCCAGAGCTGGTTGTTAAAGAGCCTGGCACCTACCCGCTCTCACTTCATCTGTGTCATCTCTGCACACTCCAGCCCACTTTCTGCCTTCAGCCAT

Ensembl | nº de acceso humano

ENSG00000128604

Nº de acceso NCBI

NM_001098627

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IRF5(3663) , IRF5(3663)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kang Sun et al.
World journal of gastroenterology, 22(42), 9368-9377 (2016-11-30)
To investigate the role of interferon regulatory factor 5 (IRF5) in reversing polarization of lung macrophages during severe acute pancreatitis (SAP) A mouse SAP model was established by intraperitoneal (ip) injections of 20 μg/kg body weight caerulein. Pathological changes in
Hongbin Cai et al.
Biochemical and biophysical research communications, 492(2), 192-198 (2017-08-19)
Ischemia-reperfusion injury (IRI) has been implicated in many pathological conditions, including cardiovascular diseases. Adhesion of leukocytes to the surface of endothelial cells has been considered as one of the principle steps in the pathological cascade of inflammatory tissue damage during
Jihyun Yang et al.
Journal of cellular physiology, 234(12), 23033-23042 (2019-05-28)
Bone-resorbing osteoclasts are differentiated from macrophages (MΦ) by M-CSF and RANKL. MΦ can be mainly classified into M1 and M2 MΦ, which are proinflammatory and anti-inflammatory, respectively, but little is known about their osteoclastogenic potential. Here, we investigated the osteoclastogenic
Ratana Lim et al.
Reproduction (Cambridge, England), 156(3), 207-218 (2018-07-15)
Preterm birth continues to be the leading cause of neonatal mortality and morbidities that can extend into adult life. Few treatment options stem from our incomplete understanding of the mechanisms of human labour and delivery. Activation of the inflammatory response
Matija Hedl et al.
Journal of immunology (Baltimore, Md. : 1950), 202(3), 920-930 (2018-12-30)
Common IFN regulatory factor 5 (IRF5) variants associated with multiple immune-mediated diseases are a major determinant of interindividual variability in pattern recognition receptor (PRR)-induced cytokines in macrophages. PRR-initiated pathways also contribute to bacterial clearance, and dysregulation of bacterial clearance can
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico