Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU138771

Sigma-Aldrich

MISSION® esiRNA

targeting human NLGN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCGCCTTTGACTTCACTGTCTCCAACTTTGTGGACAACCTGTATGGCTACCCGGAAGGCAAGGATGTGCTTCGGGAGACCATCAAGTTTATGTACACAGACTGGGCCGACCGGGACAATGGCGAAATGCGCCGCAAAACCCTGCTGGCGCTCTTTACTGACCACCAATGGGTGGCACCAGCTGTGGCCACTGCCAAGCTGCACGCCGACTACCAGTCTCCCGTCTACTTTTACACCTTCTACCACCACTGCCAGGCGGAGGGCCGGCCTGAGTGGGCAGATGCGGCGCACGGGGATGAACTGCCCTATGTCTTTGGCGTGCCCATGGTGGGTGCCACCGACCTCTTCCCCTGTAACTTCTCCAAGAATGACGTCATGCTCAGTGCCGTGGTCATGACCTACTGGACCAACTTCGCCAAGACTGGGGACCCCAACCAGCCGGTGCCGCAGGATACCAAGTTCATCCACACCAAGCCCAATCGCTTCGAGGAGGTGGTGTGGAGCAAATT

Ensembl | nº de acceso humano

ENSG00000169992

Nº de acceso NCBI

NM_020795

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NLGN2(57555) , NLGN2(57555)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Margherita Pergolizzi et al.
Biochemical and biophysical research communications, 501(1), 165-171 (2018-05-02)
The synaptic protein Neuroligin 2, similarly to its isoform Neuroligin 1, is produced by endothelial cells, but its activity in the vascular context remains unknown. This study aimed at verifying the hypothesis that Neuroligin 2, in parallel with its extraneuronal
Luan Pereira Diniz et al.
Glia, 62(12), 1917-1931 (2014-07-22)
The balance between excitatory and inhibitory synaptic inputs is critical for the control of brain function. Astrocytes play important role in the development and maintenance of neuronal circuitry. Whereas astrocytes-derived molecules involved in excitatory synapses are recognized, molecules and molecular

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico