Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU137791

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF14

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATGGGAACCCGACATTACAGATGCACCAGTTTCTTCACTTTCTAGAAGGAGGAGTAGGAGTTTGATGAAGAACAGAAGAATTTCTGGTTGTTTACATGACATACAAGTCCATCCAATTAAGAATTTGCATTCTTCACATTCATCAGGTTTAATGGACAAATCAAGCACTATTTACTCAAATTCAGCAGAGTCCTTTCTTCCTGGAATTTGCAAAGAATTGATTGGTTCTTCGTTAGATTTTTTTGGACAGAGTTATGATGAAGAAAGAACTATAGCAGACAGCCTAATTAATAGTTTTCTTAAAATTTATAATGGGCTATTTGCCATTTCCAAGGCTCATGAAGAACAAGATGAAGAAAGTCAAGATAACTTGTTTTCTTCTGATCGAGCAATCCAGTCACTTACTATTCAGACTGCATGTGCTTTTGAGC

Ensembl | nº de acceso humano

ENSG00000118193

Nº de acceso NCBI

NM_014875

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KIF14(9928) , KIF14(9928)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kay Ka-Wai Li et al.
Laboratory investigation; a journal of technical methods and pathology, 97(8), 946-961 (2017-05-16)
Medulloblastoma (MB) is the most common malignant brain tumor in childhood. At present, there is no well-established targeted drug for majority of patients. The kinesin family member 14 (KIF14) is a novel oncogene located on chromosome 1q and is dysregulated
Petra Pejskova et al.
The Journal of cell biology, 219(6) (2020-04-30)
Primary cilia play critical roles in development and disease. Their assembly and disassembly are tightly coupled to cell cycle progression. Here, we present data identifying KIF14 as a regulator of cilia formation and Hedgehog (HH) signaling. We show that RNAi
Wei Huang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(5), 1659-1670 (2015-11-05)
The mitotic kinesin superfamily protein KIF14 is essential for cytokinesis and chromosome segregation, and increased KIF14 expression is related to a variety of human cancers. However, the role of KIF14 in the development and malignant progression of astrocytomas and the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico