Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU136571

Sigma-Aldrich

MISSION® esiRNA

targeting human PREX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAGATGGGACAGCGGATTACCATAGCAACGGCTATACCGTCACCAACGGCTGGAAGATCCACAACACGGCCAAGAATAAGTGGTTTGTCTGCATGGCCAAGACGGCAGAGGAGAAGCAGAAGTGGCTGGATGCCATCATCCGCGAGCGGGAGCAGCGCGAGAGCCTGAAGCTGGGCATGGAGCGTGATGCCTACGTCATGATTGCGGAGAAGGGGGAGAAGCTGTACCACATGATGATGAACAAGAAGGTGAACCTCATCAAGGACCGCCGGAGAAAGCTGAGCACTGTCCCCAAGTGCTTTCTTGGCAATGAGTTCGTTGCCTGGCTCCTAGAAATTGGTGAAATCAGCAAGACGGAAGAAGGAGTCAACTTGGGCCAAGCCCTGTTGGAGAATGGCATCATCCACCATGTTTCCGACAAGCACCAGTTCAAGA

Ensembl | nº de acceso humano

ENSG00000124126

Nº de acceso NCBI

NM_020820

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PREX1(57580) , PREX1(57580)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HVU
YAU
DHT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jinhua Wang et al.
Cancer letters, 407, 66-75 (2017-08-15)
P-REX1 (PIP3-dependent Rac exchange factor-1) is a guanine nucleotide exchange factor that activates Rac by catalyzing exchange of GDP for GTP bound to Rac. Aberrant up-regulation of P-REX1 expression has a role in metastasis however, copy number (CN) and function
Nimisha R Kumar et al.
Scientific reports, 9(1), 16980-16980 (2019-11-20)
Molecular factors altered in corneas that develop haze post refractive surgery have been described, but pre-existing factors that predispose clinically normal corneas to aberrant fibrosis post surgery and the role of the corneal epithelium remains unknown. We analyzed the global gene
L M Dillon et al.
Oncogene, 34(30), 3968-3976 (2014-10-07)
Phosphatidylinositol 3-kinase (PI3K) promotes cancer cell survival, migration, growth and proliferation by generating phosphatidylinositol 3,4,5-trisphosphate (PIP3) in the inner leaflet of the plasma membrane. PIP3 recruits pleckstrin homology domain-containing proteins to the membrane to activate oncogenic signaling cascades. Anticancer therapeutics

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico