Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU136281

Sigma-Aldrich

MISSION® esiRNA

targeting human NPC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGATTGTGGTGTTGGCTTTTGCCAAATCTCAAATTTTCCAGATATTCTACTTCAGGATGTATTTGGCCATGGTCTTACTGGGAGCCACTCACGGATTAATATTTCTCCCTGTCTTACTCAGTTACATAGGGCCATCAGTAAATAAAGCCAAAAGTTGTGCCACTGAAGAGCGATACAAAGGAACAGAGCGCGAACGGCTTCTAAATTTCTAGCCCTCTCGCAGGGCATCCTGACTGAACTGTGTCTAAGGGTCGGTCGGTTTACCACTGGACGGGTGCTGCATCGGCAAGGCCAAGTTGAACACCGGATGGTGCCAACCATCGGTTGTTTGGCAGCAGCTTTGAACGTAGCGCCTGTGAACTCAGGAATGCACAGTTGACTTGGGAAGCAGTATTACTAGATCTGGAGGCAACCACAGGACACTAAACTTCTCCCAGCCTCTTCAGGAAAGAAACCTCATTCTTTGGCAAGCAGGAGGTGACACTAGATGGCTGTGAATGTGATCCGCTCACTGACACTCTGTAAAGGCCAATCAATGCA

Ensembl | nº de acceso humano

ENSG00000141458

Nº de acceso NCBI

NM_000271

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NPC1(4864) , NPC1(4864)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
BEV
ICV
VBV
EXU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoyang Xu et al.
Journal of cellular and molecular medicine, 21(2), 364-374 (2016-09-16)
Statins, 3-hydroxyl-3-methylglutaryl coenzyme A reductase inhibitors, are the first-line medications prescribed for the prevention and treatment of coronary artery diseases. The efficacy of statins has been attributed not only to their systemic cholesterol-lowering actions but also to their pleiotropic effects
Yudong Song et al.
Biomaterials, 150, 1-13 (2017-10-14)
Arginine and α-tocopherol succinate (α-TOS) double grafted N-trimethyl chitosan chloride (TMC) nanoparticles (TAS NPs) were designed and developed for effective co-delivery of doxorubicin (DOX) and Survivin shRNA-expressing pDNA (iSur-pDNA). With DOX loading into the hydrophobic core and iSur-pDNA combining to
Saskia Heybrock et al.
Nature communications, 10(1), 3521-3521 (2019-08-08)
The intracellular transport of cholesterol is subject to tight regulation. The structure of the lysosomal integral membrane protein type 2 (LIMP-2, also known as SCARB2) reveals a large cavity that traverses the molecule and resembles the cavity in SR-B1 that
Guanghong Liao et al.
Experimental neurology, 269, 67-74 (2015-04-14)
Niemann-Pick type C (NPC) disease is a genetic disorder associated with intracellular cholesterol accumulation in the brain and other organs, and neurodegeneration is generally believed to be the fatal cause of the disease. In view of the emerging role of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico