Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU135581

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTTCCCTCCTGTTCTCTGGTTATAGCTGGTCCCAGGTCAGCGTGGGAGGCACCTTTGGGTTCCCAGTGCCCAGCACTTTGTAGTCTCATCCCAGATTACTAACCCTTCCTGATCCTGGAGAGGCAGGGATAGTAAATAAATTGCTCTTCCTACCCCATCCCCCATCCCCTGACAAAAAGTGACGGCAGCCGTACTGAGTCTGTAAGGCCCAAAGTGGGTACAGACAGCCTGGGCTGGTAAAAGTAGGTCCTTATTTACAAGGCTGCGTTAAAGTTGTACTAGGCAAACACACTGATGTAGGAAGCACGAGGAAAGGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bufeng Zhuang et al.
Molecular medicine reports, 19(5), 3933-3940 (2019-03-01)
Dysregulated microRNAs (miRNAs/miRs) directly modulate the biological functions of non‑small cell lung cancer (NSCLC) cells and contribute to the initiation and progression of NSCLC; however, the specific roles and underlying mechanisms of the dysregulated miRNAs in NSCLC require further investigation.
J Justin Milner et al.
Nature, 552(7684), 253-257 (2017-12-07)
Tissue-resident memory CD8
Jikui Sun et al.
Oncotarget, 8(67), 110785-110796 (2018-01-18)
Accumulating data demonstrates that the network dysregulation of microRNA-medicated target genes is involved in glioma. We have previously found miR-19a/b overexpression in glioma cell lines and specimens with various tumour grades. However, there was no report on the function and
Haiping Yang et al.
International journal of molecular medicine, 40(5), 1466-1476 (2017-09-28)
Bronchopulmonary dysplasia (BPD) is a major challenge for premature infants; however, the underlying mechanisms remain unclear. We previously reported that epithelial-mesenchymal transition (EMT) in alveolar type II (AT2) epithelial cells influences the normal alveolar development process. In this study, we wished to examine whether
Lin Shi et al.
Cell stress & chaperones, 25(5), 793-802 (2020-07-19)
Lung toxicity is the main cause of the death from methamphetamine (MA) abuse, but its mechanism has remained unclear. The purpose of our study was to investigate if MA can induce epithelial-to-mesenchymal transition (EMT) and if RUNX3 is involved in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico