Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU134591

Sigma-Aldrich

MISSION® esiRNA

targeting human PDE4B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCAGGAAAGAGACCTCCTAAAGACATTCAGAATCTCATCTGACACATTTATAACCTACATGATGACTTTAGAAGACCATTACCATTCTGACGTGGCATATCACAACAGCCTGCACGCTGCTGATGTAGCCCAGTCGACCCATGTTCTCCTTTCTACACCAGCATTAGACGCTGTCTTCACAGATTTGGAGATCCTGGCTGCCATTTTTGCAGCTGCCATCCATGACGTTGATCATCCTGGAGTCTCCAATCAGTTTCTCATCAACACAAATTCAGAACTTGCTTTGATGTATAATGATGAATCTGTGTTGGAAAATCATCACCTTGCTGTGGGTTTCAAACTGCTGCAAGAAGAACACTGTGACATCTTCATGAATCTCACCAAGAAGCAGCGTCAGACAC

Ensembl | nº de acceso humano

ENSG00000184588

Nº de acceso NCBI

NM_001037339

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PDE4B(5142) , PDE4B(5142)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XZS
QLS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xue-Qi Liu et al.
Biochemical pharmacology, 180, 114132-114132 (2020-07-06)
Acute kidney injury (AKI), characterized by a rapid decline in renal function, is triggered by an acute inflammatory response that leads to kidney damage. An effective treatment for AKI is lacking. Using in vitro and in vivo AKI models, our
Dan Li et al.
International immunopharmacology, 90, 107176-107176 (2020-11-28)
Roflupram (ROF) is a novel phosphodiesterase 4 inhibitor. We previously found that ROF suppressed the production of pro-inflammatory factors in microglial cells; however, the underlying mechanisms are largely unknown. The present study aimed to elucidate the underlying molecular mechanisms of
Jiahong Zhong et al.
Free radical biology & medicine, 135, 87-101 (2019-03-01)
The etiology of Parkinson's disease (PD) is generally not well understood, but it is believed to involve excessive oxidative insult. Hence, identifying therapeutic targets and compounds that exhibit protective effects against oxidative damage is a reasonable strategy to slow down
Hongyan Ma et al.
Biochemical and biophysical research communications, 450(4), 1560-1567 (2014-07-16)
Acute lung injury (ALI), acute respiratory distress syndrome (ARDS), is actually involved in an ongoing and uncontrolled inflammatory response in lung tissues. Although extensive studies suggested that phospodiesterase type 4B (PDE4B) may be related to inflammation, the underlying cell biological

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico