Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU134341

Sigma-Aldrich

MISSION® esiRNA

targeting human RPN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCCACTGAAGTTGGCATCACAAATGTTGATCTTTCCACCGTGGATAAGGATCAGAGCATTGCACCCAAAACTACCCGGGTGACATACCCAGCCAAAGCCAAGGGCACATTCATCGCAGACAGCCACCAGAACTTCGCCTTGTTCTTCCAGCTGGTAGATGTGAACACTGGTGCTGAACTCACTCCTCACCAGACATTTGTCCGACTCCATAACCAGAAGACTGGCCAGGAAGTGGTGTTTGTTGCCGAGCCAGACAACAAGAACGTGTACAAGTTTGAACTGGATACCTCTGAAAGAAAGATTGAATTTGACTCTGCCTCTGGCACCTACACTCTCTACTTAATCATTGGAGATGCCACTTTGAAGAACCCAATCCTCTGGAATGTGGCTGATGTGGTCATC

Ensembl | nº de acceso humano

ENSG00000118705

Nº de acceso NCBI

NM_001135771

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RPN2(6185) , RPN2(6185)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jinhai Ren et al.
Experimental biology and medicine (Maywood, N.J.), 245(12), 1009-1015 (2020-05-26)
This study explored the role of ribophorin II (RPN2) in myelodysplastic syndromes (MDSs) cell proliferation and growth and revealed that RPN2 knockdown suppressed OCI-AML3 cell growth and proliferation and triggered cell cycle arrest and elicited apoptosis in OCI-AML3 cells. In
Gabriela Vazquez Rodriguez et al.
Frontiers in oncology, 10, 598684-598684 (2020-12-18)
The majority of estrogen receptor positive (ER+) breast cancer (BC) maintain the ER at metastatic sites. Despite anti-estrogen therapy, almost 30% of ER+ BC patients relapse. Thus, new therapeutic targets for ER+ BC are needed. Amino acids (AAs) may affect

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico