Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU133931

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

N Balaguer et al.
Molecular human reproduction, 24(8), 411-425 (2018-05-31)
Is there a specific mechanism to load the microRNA (miRNA), hsa-miR-30d, into exosomes to facilitate maternal communication with preimplantation embryos? The heterogeneous nuclear ribonucleoprotein C1 (hnRNPC1) is involved in the internalization of endometrial miR-30d into exosomes to prepare for its
Zuzana Cieniková et al.
RNA (New York, N.Y.), 21(11), 1931-1942 (2015-09-16)
The human hnRNP C is a ubiquitous cellular protein involved in mRNA maturation. Recently, we have shown that this protein specifically recognizes uridine (U) pentamers through its single RNA recognition motif (RRM). However, a large fraction of natural RNA targets
Na Li et al.
Nature cell biology, 16(11), 1080-1091 (2014-10-27)
Cyclin C was cloned as a growth-promoting G1 cyclin, and was also shown to regulate gene transcription. Here we report that in vivo cyclin C acts as a haploinsufficient tumour suppressor, by controlling Notch1 oncogene levels. Cyclin C activates an

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico