Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU133161

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1H4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGGACCATGAAGACCAGATTGCTTTGCTGAAAGGGTCTGCGGTTGAAGCTATGTTCCTTCGTTCAGCTGAGATTTTCAATAAGAAACTTCCGTCTGGGCATTCTGACCTATTGGAAGAAAGAATTCGAAATAGTGGTATCTCTGATGAATATATAACACCTATGTTTAGTTTTTATAAAAGTATTGGGGAACTGAAAATGACTCAAGAGGAGTATGCTCTGCTTACAGCAATTGTTATCCTGTCTCCAGATAGACAATACATAAAGGATAGAGAGGCAGTAGAGAAGCTTCAGGAGCCACTTCTTGATGTGCTACAAAAGTTGTGTAAGATTCACCAGCCTGAAAATCCTCAACACTTTGCCTGTCTCCTGGGTCGCCTGACTGAATTACGGACATTCAATCATCACCACGCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ting Fu et al.
Molecular endocrinology (Baltimore, Md.), 30(1), 92-103 (2015-10-28)
The bile acid (BA)-sensing nuclear receptor, farnesoid X receptor (FXR), regulates postprandial metabolic responses, including inhibition of BA synthesis, by inducing the intestinal hormone, fibroblast growth factor (FGF)15 (FGF19 in human). In this study, we tested a novel hypothesis that
Wenxuan Xu et al.
IUBMB life, 68(5), 376-387 (2016-03-31)
Hepatic stellate cells (HSCs) are universally acknowledged to play a stimulative role in the pathogenesis of hepatic fibrosis and portal hypertension. HSCs when activated in response to liver injury are characterized with many changes, with HSC contraction being the most
Hai Hu et al.
Oncotarget, 8(20), 33265-33275 (2017-04-13)
Bile acids (BAs) was critical in the initiation and progression of various tumors. However, their prognostic significance in pancreatic cancer was still illusive. In the present study, the expression and biological significance of FXR, a major receptor of BAs, in
Wenxuan Xu et al.
Toxicology and applied pharmacology, 315, 23-34 (2016-12-13)
Alcoholic liver disease (ALD) is a common etiology of liver diseases, characterized by hepatic steatosis. We previously identified farnesoid X receptor (FXR) as a potential therapeutic target for ALD. Dihydroartemisinin (DHA) has been recently identified to possess potent pharmacological activities
Renchao Dong et al.
European journal of pharmacology, 857, 172461-172461 (2019-06-21)
Estrogen-induced cholestasis is a common etiology of hepatic diseases in women with contraceptives administration, pregnancy or hormone replacement therapy. Farnesoid X receptor (FXR) is a member of nuclear receptor super family of ligand-activated transcription factors that is highly expressed in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico