Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU132681

Sigma-Aldrich

MISSION® esiRNA

targeting human IFI16

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGCTCCACCCAACAGTTCTTCAACTGAGAACCCGAAAACAGTGGCCAAATGTCAGGTAACTCCCAGAAGAAATGTTCTCCAAAAACGCCCAGTGATAGTGAAGGTACTGAGTACAACAAAGCCATTTGAATATGAGACCCCAGAAATGGAGAAAAAAATAATGTTTCATGCTACAGTGGCTACACAGACACAGTTCTTCCATGTGAAGGTTTTAAACACCAGCTTGAAGGAGAAATTCAATGGAAAGAAAATCATCATCATATCAGATTATTTGGAATATGATAGTCTCCTAGAGGTCAATGAAGAATCTACTGTATCTGAAGCTGGTCCTAACCAAACGTTTGAGGTTCCAAATAAAATCATCAACAGAGCAAAGGAAACTCTGAAGATTGATATTCTTCACAAACAAGCTTCAGGA

Ensembl | nº de acceso humano

ENSG00000163565

Nº de acceso NCBI

NM_005531

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IFI16(3428) , IFI16(3428)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cindy Orvain et al.
The Journal of clinical investigation, 130(7), 3777-3790 (2020-04-03)
Hidradenitis suppurativa (HS) is a chronic, relapsing, inflammatory skin disease. HS appears to be a primary abnormality in the pilosebaceous-apocrine unit. In this work, we characterized hair follicle stem cells (HFSCs) isolated from HS patients and more precisely the outer
A Berry et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 24(6), 1700-1713 (2010-01-21)
Previously, we used cDNA expression profiling to identify genes associated with glucocorticoid (Gc) sensitivity. We now identify which of these directly influence Gc action. Interferon-inducible protein 16 (IFI16), bone morphogenetic protein receptor type II (BMPRII), and regulator of G-protein signaling
Stine Søby et al.
Herpesviridae, 3(1), 6-6 (2012-10-16)
Innate recognition is essential in the antiviral response against infection by herpes simplex virus (HSV). Chemokines are important for control of HSV via recruitment of natural killer cells, T lymphocytes, and antigen-presenting cells. We previously found that early HSV-1-mediated chemokine
Xin Duan et al.
PloS one, 6(5), e19532-e19532 (2011-05-17)
Glucose restriction in cells increases the AMP/ATP ratio (energetic stress), which activates the AMPK/p53 pathway. Depending upon the energetic stress levels, cells undergo either autophagy or cell death. Given that the activated p53 induces the expression of IFI16 protein, we
Grazia Rosaria Gariano et al.
PLoS pathogens, 8(1), e1002498-e1002498 (2012-02-01)
Human interferon (IFN)-inducible IFI16 protein, an innate immune sensor of intracellular DNA, modulates various cell functions, however, its role in regulating virus growth remains unresolved. Here, we adopt two approaches to investigate whether IFI16 exerts pro- and/or anti-viral actions. First
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico